Padlock probe module [New in 2.0] ******************************************************** The circtools padlock module is a specialized primer design tool tailored specifically for next-generation spatial transcriptomics technology. ``circtools padlock`` is able to design padlock probes in batches of hundreds of circRNAs and linear RNAs based on circRNAs detected with ``circtools detect``, but can also work on lists of linear RNAs or circRNA isoforms or even entirely without any preliminary data purely based on the FASTA sequence of the circRNA. Required tools and packages ---------------------------- ``circtools padlock`` depends on R, several R packages, and BioPython: R packages: * primex * formattable * kableExtra * dplyr * RColorBrewer * colortools Python libraries: * BioPython>=1.71 All R package as well as Python dependencies are installed during the circtools installation. General usage -------------- A call to ``circtools padlock --help`` shows all available command line flags: .. code-block:: bash usage: circtools [-h] -d DCC_FILE -g GTF_FILE -f FASTA_FILE [-O {mm,hs}] [-s SEQUENCE_FILE] [-o OUTPUT_DIR] [-T EXPERIMENT_TITLE] [-t GLOBAL_TEMP_DIR] [-G GENE_LIST [GENE_LIST ...]] [-p PRODUCT_SIZE [PRODUCT_SIZE ...]] [-i ID_LIST [ID_LIST ...]] [-j {r,n,f}] [-b] circular RNA primer design optional arguments: -h, --help show this help message and exit Input: -d DCC_FILE, --dcc-file DCC_FILE CircCoordinates file from DCC / detect module -g GTF_FILE, --gtf-file GTF_FILE GTF file of genome annotation e.g. ENSEMBL -f FASTA_FILE, --fasta FASTA_FILE FASTA file with genome sequence (must match annotation) -O {mm,hs}, --organism {mm,hs} Organism of the study (used for primer BLASTing), mm = Mus musculus, hs = Homo sapiens -s SEQUENCE_FILE, --sequence SEQUENCE_FILE FASTA file containing the circRNA sequence (exons and introns) Output options: -o OUTPUT_DIR, --output OUTPUT_DIR Output directory (must exist) -T EXPERIMENT_TITLE, --title EXPERIMENT_TITLE Title of the experiment for HTML output and file name Additional options: -t GLOBAL_TEMP_DIR, --temp GLOBAL_TEMP_DIR Temporary directory (must exist) -G GENE_LIST [GENE_LIST ...], --genes GENE_LIST [GENE_LIST ...] Space-separated list of host gene names. Primers for CircRNAs of those genes will be designed.E.g. -G "CAMSAP1" "RYR2" -p PRODUCT_SIZE [PRODUCT_SIZE ...], --product-size PRODUCT_SIZE [PRODUCT_SIZE ...] Space-separated range for the desired PCR product. E.g. -p 80 160 [default] -i ID_LIST [ID_LIST ...], --id-list ID_LIST [ID_LIST ...] Space-separated list of circRNA IDs. E.g. -i "CAMSAP1_9_135850137_135850461_-" "CAMSAP1_9_135881633_135883078_-" -j {r,n,f}, --junction {r,n,f} Should the forward [f] or reverse [r] primer be located on the BSJ? [Default: n] -b, --no-blast Should primers be BLASTED? Even if selected yes here, not more than 50 primers willbe sent to BLAST in any case. -r, --rna-type Flag for RNA type for which you want to generate padlock probes . 0 for Circular RNAs only, 1 for Linear RNAs only and 2 for Both. DEFAULT 2 -svg, --no-svg Should the SVG files for graphical representation be generated? Designing probes with circtools padlock ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ A sample call to padlock using the `Jakobi et al. 2016 `_ data requires as only external parameter the Fasta sequence of the reference genome in order to obtain DNA sequences for the probe design process. .. code-block:: bash # obtain reference genome (if not already downloaded) wget ftp://ftp.ensembl.org/pub/release-90/fasta/mus_musculus/dna/Mus_musculus.GRCm38.dna.primary_assembly.fa.gz # obtain annotation (if not already downloaded) wget ftp://ftp.ensembl.org/pub/release-90/gtf/mus_musculus/Mus_musculus.GRCm38.90.gtf.gz # unzip gzip -d Mus_musculus.GRCm38.dna.primary_assembly.fa.gz gzip -d Mus_musculus.GRCm38.90.gtf.gz # run circtools padlock, design primer for linear RNA Slc8a1 circtools padlock -f Mus_musculus.GRCm38.dna.primary_assembly.fa -g Mus_musculus.GRCm38.90.gtf -O mm -G Slc8a1 -T "Slc8a1 probes" -r 1 -b .. code-block:: bash Start parsing GTF file Start merging GTF file outside the function Finding probes for linear RNAs Slc8a1_17_81388690_81389067_-_0 CTACTGCCACATAAAGGGCT TCTAAGGGAAGATGACGATG 55 52 69 50 45 neutral Slc8a1_17_81388690_81389067_-_1 TACTGCCACATAAAGGGCTT CTAAGGGAAGATGACGATGA 55 52 69 45 45 neutral Slc8a1_17_81388690_81389067_-_2 ACTGCCACATAAAGGGCTTC TAAGGGAAGATGACGATGAT 56 51 70 50 40 neutral Slc8a1_17_81388690_81389067_-_3 CTGCCACATAAAGGGCTTCT AAGGGAAGATGACGATGATG 56 53 69 50 45 preferred Slc8a1_17_81388690_81389067_-_4 TGCCACATAAAGGGCTTCTA AGGGAAGATGACGATGATGA 54 54 70 45 45 neutral Slc8a1_17_81388690_81389067_-_5 GCCACATAAAGGGCTTCTAA GGGAAGATGACGATGATGAT 53 53 69 45 45 preferred Slc8a1_17_81388690_81389067_-_8 ACATAAAGGGCTTCTAAGGG AAGATGACGATGATGATGAA 52 50 67 45 35 preferred Slc8a1_17_81388690_81389067_-_9 CATAAAGGGCTTCTAAGGGA AGATGACGATGATGATGAAT 52 50 66 45 35 neutral Slc8a1_17_81388690_81389067_-_10 ATAAAGGGCTTCTAAGGGAA GATGACGATGATGATGAATG 51 50 66 40 40 preferred User disabled BLAST search, skipping. Formatting linear RNA probe outputs Writing linear results to test_Slc8a1/circtools_padlock_probe_design_linear_FSJ.html Writing linear probe results to test_Slc8a1/circtools_padlock_probe_design_linear_FSJ.csv Cleaning up ``circtools padlock`` takes a few seconds to process the input data and sends the generated probe pairs to the web-based BLAST service of the NCBI in order to give the user hints about potential unwanted off-site targets. The output is written to a HTML and CSV file which can be opened with any browser. Sample of the HTML output generated by ``circtools padlock`` ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ .. image:: /img/padlock_doc_html_Slc8a1.png